To access your account, log in or register.	shopping cart | log in

FAQs for Nucleic Acids Technical Reference for Nucleic Acids Enzyme Finder NEBcutter NEBuffer Chart Double Digest Finder Isoschizomers DNA Sequences and Maps REBASE

Home > Products > Nucleic Acids > Primers > GPS Primers > PrimerS (30-mer) PrimerS (30-mer) Will be discontinued as of April 1, 2009 Catalog # Size Concentration Price Qty   S1266S 0.5 A260 units   $100.00 Prices are in US dollars and valid only for US orders. Download: MSDS PDF Description: This primer generates sequence data from target DNA adjacent to the Tn7L (SpeI) end of the Transprimer element. It is complementary to the Transprimer sequence 31-61 nucleotides from the end of the Tn7L (SpeI) end of the element. Sequence: 5´d(ATAATCCTTAAAAACTCCATTTCCACCCCT) 3´ Phosphorylated: No Length: 30 -mer Properties & Usage Supplied As: Lyophilized Triethylammonium Salt Suggested Working Concentration: 10 μM Recommended Resuspension Volume: 159 μl Storage Conditions Storage Temperature: -20°C