To access your account, log in or register.	shopping cart | log in

FAQs for Nucleic Acids Technical Reference for Nucleic Acids Enzyme Finder NEBcutter NEBuffer Chart Double Digest Finder Isoschizomers DNA Sequences and Maps REBASE

Home > Products > Nucleic Acids > Primers > IMPACT Primers > Intein Forward Primer (24-mer) Intein Forward Primer (24-mer) Catalog # Size Concentration Price Qty   S1263S 0.5 A260 units   $100.00 Prices are in US dollars and valid only for US orders. Download: MSDS PDF Description: This primer is complementary to the intein sequence 117-141 nucleotides upstream from the C-terminal cleavage site in pTYB11 and pTYB12 vectors. Sequence: 5´ d(CCCGCCGCTGCTTTTGCACGTGAG) 3´ Phosphorylated: No Orientation: Forward Length: 24 -mer Properties & Usage Supplied As: Lyophilized Triethylammonium Salt Suggested Working Concentration: 10 μM Recommended Resuspension Volume: 216 μl Storage Conditions Storage Temperature: -20°C