To access your account, log in or register.	shopping cart | log in

FAQs for Nucleic Acids Technical Reference for Nucleic Acids Enzyme Finder NEBcutter NEBuffer Chart Double Digest Finder Isoschizomers DNA Sequences and Maps REBASE

Home > Products > Nucleic Acids > Primers > IMPACT Primers > Intein Reverse Primer (24-mer) Intein Reverse Primer (24-mer) Catalog # Size Concentration Price Qty   S1261S 0.5 A260 units   $100.00 Prices are in US dollars and valid only for US orders. Download: MSDS PDF Description: This primer generates sequence data from the 3´ region of the target gene after it is cloned into the pTYB1, pTYB2, pTYB3, and pTYB4 and pKYB1 vectors. This primer is complementary to the intein sequence 64-87 nucleotides downstream from the N-terminal splice junction (the cleavage site). Sequence: 5´ d(ACCCATGACCTTATTACCAACCTC) 3´ Phosphorylated: No Orientation: Reverse Length: 24 -mer Properties & Usage Supplied As: Lyophilized Triethylammonium Salt Suggested Working Concentration: 10 μM Recommended Resuspension Volume: 204 μl Storage Conditions Storage Temperature: -20°C