To access your account, log in or register.	shopping cart | log in

FAQs for Nucleic Acids Technical Reference for Nucleic Acids Enzyme Finder NEBcutter NEBuffer Chart Double Digest Finder Isoschizomers DNA Sequences and Maps REBASE

Home > Products > Nucleic Acids > Primers > Ph.D. gIII Sequencing Primers > -96 glll Sequencing Primer (20-mer) -96 glll Sequencing Primer (20-mer) Catalog # Size Concentration Price Qty   S1259S 0.5 A260 units   $100.00 Prices are in US dollars and valid only for US orders. Download: MSDS PDF Description: This primer is suitable for characterizing peptide sequences selected by biopanning with the Ph.D.™ Phage Display Peptide Library Kit (NEB #E8100). After annealing to the single-stranded Ph.D. phage display vector, the 3´ end of the primer lies 96 nucleotides back from the randomized region. Sequence: 5´ d(CCCTCATAGTTAGCGTAACG) 3´ Phosphorylated: No Length: 20 -mer Properties & Usage Supplied As: Lyophilized Triethylammonium Salt Suggested Working Concentration: 10 μM Recommended Resuspension Volume: 240 μl Storage Conditions Storage Temperature: -20°C