 |
|
 |
 |
 |
| Home >
Products >
Protein Tools >
Phage Display >
Ph.D. gIII Sequencing Primers >
-96 glll Sequencing Primer (20-mer) |
 |  |  | | -96 glll Sequencing Primer (20-mer) |  | |  |
 |
|
Prices are in US dollars and valid only for US orders.
|

 Description: This primer is suitable for characterizing peptide sequences selected by biopanning with the Ph.D.™ Phage Display Peptide Library Kit (NEB #E8100). After annealing to the single-stranded Ph.D. phage display vector, the 3´ end of the primer lies 96 nucleotides back from the randomized region.
Sequence: 5´ d(CCCTCATAGTTAGCGTAACG) 3´ Phosphorylated:
No
Length: 20 -mer
Properties & Usage

 Supplied As: Lyophilized Triethylammonium Salt
Suggested Working Concentration: 10 μM Recommended Resuspension Volume: 240 μl
Storage Conditions

 Storage Temperature: -20°C
|
|
 |
 |
 |
New
England Biolabs, Inc. is an ISO 9001 and ISO
14001 Certified Company.
NEB certifies that it is a small business in accordance with the US Small Business Administration and 13 CFR 121.201 |
 |
 |
|
 |