 |
|
 |
 |
 |
| Home >
Products >
Nucleic Acids >
Primers >
Ph.D. gIII Sequencing Primers >
-28 glll Sequencing Primer (22-mer) |
 |  |  | | -28 glll Sequencing Primer (22-mer) |  | |  |
 |
|
Prices are in US dollars and valid only for US orders.
|

 Description: This primer is suitable for characterizing peptide sequences selected by biopanning with the Ph.D.™ Phage Display Peptide Library Kit (NEB #E8100S). After annealing to the single-stranded Ph.D. phage display vector, the 3´ end of the primer lies 28 nucleotides back from the randomized region.
Sequence: 5´ d(GTATGGGATTTTGCTAAACAAC) 3´ Phosphorylated:
No
Length: 22 -mer
Properties & Usage

 Supplied As: Lyophilized Triethylammonium Salt
Suggested Working Concentration: 10 μM Recommended Resuspension Volume: 200 μl
Storage Conditions

 Storage Temperature: -20°C
| |
 |
 |
|
 |