To access your account, log in or register.	shopping cart | log in

FAQs for Nucleic Acids Technical Reference for Nucleic Acids Enzyme Finder NEBcutter NEBuffer Chart Double Digest Finder Isoschizomers DNA Sequences and Maps REBASE LITMUS 28/38 Forward Sequencing Primer (21-mer) LITMUS 28i Vector LITMUS 38i Vector

Home > Products > Nucleic Acids > Primers > LITMUS Sequencing Primers > LITMUS 28/38 Reverse Sequencing Primer (21-mer) LITMUS 28/38 Reverse Sequencing Primer (21-mer) Catalog # Size Concentration Price Qty   S1251S 0.5 A260 units   $100.00 Prices are in US dollars and valid only for US orders. Download: MSDS PDF Description: This primer generates sequence data from the central section of the poylinker region of LITMUS vectors 28 and 38. After annealing the 5´ end of the primer is located at base 2534 of the LITMUS 28 vector and base 2525 of the LITMUS 38 vector. Sequence: 5´ d(GTGGATCCAGATATCCTGCAG) 3´ Phosphorylated: No Orientation: Reverse Length: 21 -mer Properties & Usage Supplied As: Lyophilized Triethylammonium Salt Suggested Working Concentration: 10 μM Recommended Resuspension Volume: 220 μl Storage Conditions Storage Temperature: -20°C Companion Products LITMUS 28/38 Forward Sequencing Primer (21-mer) LITMUS 28i Vector LITMUS 38i Vector