To access your account, log in or register.	shopping cart | log in

FAQs for DNA Modifying Enzymes and Cloning Technical Reference for DNA Modifying Enzymes and Cloning Enzyme Finder NEBcutter NEBuffer Chart Double Digest Finder PCR Selection Tool Isoschizomers DNA Sequences and Maps REBASE

Home > Products > DNA Modifying Enzymes and Cloning > Cloning and Mutagenesis > T7 Universal Primer (20-mer) T7 Universal Primer (20-mer) Catalog # Size Concentration Price Qty   S1248S 0.5 A260 units   $104.00 Prices are in US dollars and valid only for US orders. Download: MSDS PDF Description: This primer anneals to the T7 Promoter region of any vector containing the T7 Promoter. Sequence: 5´ d(TAATACGACTCACTATAGGG) 3´ Phosphorylated: No Length: 20 -mer Properties & Usage Supplied As: Lyophilized Triethylammonium Salt Suggested Working Concentration: 10 μM Recommended Resuspension Volume: 220 μl Storage Conditions Storage Temperature: -20°C References Wallace, R.B. et al. (1981) Gene, 16, 21-26. New England Biolabs, Inc. is an ISO 9001 and ISO 14001 Certified Company. NEB certifies that it is a small business in accordance with the US Small Business Administration and 13 CFR 121.201