 |
|
 |
 |
 |
| Home >
Products >
Nucleic Acids >
Primers >
Transcription Promoter Primers >
T7 Universal Primer (20-mer) |
 |  |  | | T7 Universal Primer (20-mer) |  | |  |
 |
|
Prices are in US dollars and valid only for US orders.
|

 Description: This primer anneals to the T7 Promoter region of any vector containing the T7 Promoter.
Sequence: 5´ d(TAATACGACTCACTATAGGG) 3´ Phosphorylated:
No
Length: 20 -mer
Properties & Usage

 Supplied As: Lyophilized Triethylammonium Salt
Suggested Working Concentration: 10 μM Recommended Resuspension Volume: 220 μl
Storage Conditions

 Storage Temperature: -20°C
References


- Wallace, R.B. et al. (1981) Gene, 16, 21-26.
| |
 |
 |
|
 |