To access your account, log in or register.	shopping cart | log in

FAQs for Nucleic Acids Technical Reference for Nucleic Acids Enzyme Finder NEBcutter NEBuffer Chart Double Digest Finder Isoschizomers DNA Sequences and Maps REBASE

Home > Products > Nucleic Acids > Primers > malE Primer > malE Primer (24-mer) malE Primer (24-mer) Catalog # Size Concentration Price Qty   S1237S 0.5 A260 units   $100.00 Prices are in US dollars and valid only for US orders. Download: MSDS PDF Description: This primer generates sequence data from inserts in the polylinker region of the plasmids pMal-C and pMal-P (or any malE vector). After annealing the primer, the 3´ end is 57 bases from the 5´ end of the StuI restriction site and 73 bases from the XmnI site in the plasmids pMal-c2 and pMal-p2. Sequence: 5´d(GGTCGTCAGACTGTCGATGAAGCC) 3´ Phosphorylated: No Length: 24 -mer Properties & Usage Supplied As: Lyophilized Triethylammonium Salt Suggested Working Concentration: 10 μM Recommended Resuspension Volume: 190 μl Storage Conditions Storage Temperature: -20°C References Wallace, R.B. et al. (1981) Gene, 16, 21-26.