To access your account, log in or register.	shopping cart | log in

FAQs for Nucleic Acids Technical Reference for Nucleic Acids Enzyme Finder NEBcutter NEBuffer Chart Double Digest Finder Isoschizomers DNA Sequences and Maps REBASE

Home > Products > Nucleic Acids > Primers > Transcription Promoter Primers > T3 Promoter Primer (20-mer) T3 Promoter Primer (20-mer) Catalog # Size Concentration Price Qty   S1228S 0.5 A260 units   $100.00 Prices are in US dollars and valid only for US orders. Download: MSDS PDF Description: This primer is complementary to the consensus sequence in all Class III (1) promoters for T3 RNA Polymerase. At a 15 to 1 primer to template molar ratio, specific priming of the T3 promotor sequence over the T7 class III conserved sequence (1) was observed in the pKS plasmid (2). Sequence: 5´d(ATTAACCCTCACTAAAGGGA) 3´ Phosphorylated: No Length: 20 -mer Properties & Usage Supplied As: Lyophilized Triethylammonium Salt Suggested Working Concentration: 10 μM Recommended Resuspension Volume: 220 μl Storage Conditions Storage Temperature: -20°C References McAllister, W.T., MacWright, R.S., Joliffe, L.K., Dembinski, D.R., Cleaves, G.R., Bailey, J.N. and McGraw, N.J. (1985) Nucl. Acids Res., 18, 6753-6766.