To access your account, log in or register.	shopping cart | log in

FAQs for Nucleic Acids Technical Reference for Nucleic Acids Enzyme Finder NEBcutter NEBuffer Chart Double Digest Finder Isoschizomers DNA Sequences and Maps REBASE

Home > Products > Nucleic Acids > Primers > Transcription Promoter Primers > SP6 Promoter Primer (24-mer) SP6 Promoter Primer (24-mer) Catalog # Size Concentration Price Qty   S1226S 0.5 A260 units   $100.00 Prices are in US dollars and valid only for US orders. Download: MSDS PDF Description: This primer is complementary to a portion of the SP6 RNA Polymerase promoter including the transcription start site (G residue) and can be used to sequence DNA inserted in the polylinker regions of the cloning vectors pSP64 and SP65 (1). Using a modification of the supercoiled sequencing procedure developed by Chen and Seeburg (2), sequencing data can be generated in excess of 350 bases from the double-stranded plasmid. Sequence: 5´ d(CATACGATTTAGGTGACACTATAG) 3´ Phosphorylated: No Length: 24 -mer Properties & Usage Supplied As: Lyophilized Triethylammonium Salt Suggested Working Concentration: 10 μM Recommended Resuspension Volume: 180 μl Storage Conditions Storage Temperature: -20°C References Melton, D.A., Krieg, P.A., Rebagliati, M.R., Maniatis, T., Zinn, K. and Green, M.R. (1984) Nucl. Acids Res., 12, 7035-7056. Chen, E. et al. (1984) DNA, 4, 165-170.