To access your account, log in or register.	shopping cart | log in

FAQs for Nucleic Acids Technical Reference for Nucleic Acids Enzyme Finder NEBcutter NEBuffer Chart Double Digest Finder Isoschizomers DNA Sequences and Maps REBASE

Home > Products > Nucleic Acids > Primers > M13/pUC Primers > M13/pUC Sequencing Primer (-47) (24-mer) M13/pUC Sequencing Primer (-47) (24-mer) Catalog # Size Concentration Price Qty   S1224S 0.5 A260 units   $100.00 Prices are in US dollars and valid only for US orders. Download: MSDS PDF Description: This primer is suitable for sequencing in the M13-mp2, mp5, mp7, mp8...19 (1,2), MWJ22(3) and pUC vectors ( i.e. pUC7, pUC8, pUC9...19) (2). After annealing to M13mp18-lac template DNA the 5´ end of the primer lies 47 nucleotides back from the HindIII restriction site. Sequence: 5´ d(CGCCAGGGTTTTCCCAGTCACGAC) 3´  Phosphorylated: No Length: 24 -mer Properties & Usage Supplied As: Lyophilized Triethylammonium Salt Suggested Working Concentration: 10 μM Recommended Resuspension Volume: 210 μl Storage Conditions Storage Temperature: -20°C References Heidecker, G., Messing, J. and Groneborn, B. (1980) Gene, 10, 69-73. Messing, J., Vieira, J., Yanish-Perron, C. (1984) Gene, 33, 102-119. Rothstein, R., Lall, L.F., Bahl, C.P., Narang, S.A. and Wu, R. (1979) R. Wu (Eds.), Methods Enzymol., 68, pp. 98-109. New York: Academic Press.