New England Biolabs
To access your account, log in or register.
Products Technical Reference Customer Service My NEB Account
Contact NEB About Us Site Map Request a Catalog OEM at NEB International Orders Freezer Program Quick Order
Related Information
FAQs for I-CeuI
FAQs for Restriction Endonucleases
Technical Reference for Restriction Endonucleases
Favorite Tools
Enzyme Finder
NEBcutter
NEBuffer Chart
Double Digest Finder
PCR Selection Tool
Isoschizomers
DNA Sequences
and Maps
REBASE
Related Products
Reagents Sold Separately
NEBuffer 4
BSA
Discounts, Limited Offers and Value Purchases
I-CeuI
Recombinant SourceNEBuffer 4BSA37Heat Inactivated
Catalog # Size Concentration Price Qty  
R0699L 2,500 units 5,000 units/ml $264.00
R0699S 500 units 5,000 units/ml $66.00
Prices are in US dollars and valid only for US orders.
Download:MSDS PDF


Recognition Site:

CGTAACTATAACGGTCCTAAGGTAGCGAA

isoschizomers | compatible ends | single letter code

Description:
I-CeuI is an intron-encoded endonuclease. The intron encoding I-CeuI is present in the chloroplast large rRNA gene of Chlamydomonas eugametos (1). This gene has been cloned and overexpressed in E. coli (2).

Source:
A E. coli strain that carries the I-CeuI gene from Chlamydomonas eugametos (C. Lemieux).

Reagents Supplied:
NEBuffer 4 (10X)
BSA (100X)
pBHS ScaI-linearized Control Plasmid (5 μg)


Enzyme Properties


Activity in NEBuffers:
NEBuffer 1:10%
NEBuffer 2:10%
NEBuffer 3:0%
NEBuffer 4:100%

When using a buffer other than the optimal (supplied) NEBuffer, it may be necessary to add more enzyme to achieve complete digestion.

Heat Inactivation:
65°C for 20 minutes

Survival in a Reaction:
(+ +) Intermediate activity. Suitable for extended digestion, but < 8 hours.
More information about: Extended Digests with Restriction Enzymes


Reaction & Storage Conditions


Reaction Conditions:
1X NEBuffer 4
Supplemented with 100 μg/ml Bovine Serum Albumin
Incubate at 37°C.

1X NEBuffer 4:
20 mM Tris-acetate
50 mM potassium acetate
10 mM Magnesium Acetate
1 mM Dithiothreitol
pH 7.9 @ 25°C

Unit Definition:
One unit is defined as the amount of enzyme required to cleave 1 µg of pBHS ScaI-linearized Control Plasmid in 3 hours at 37°C in a total reaction volume of 50 µl.

Concentration:
5,000 units/ml

Unit Assay Substrate:
pBHS ScaI-linearized Control Plasmid

Storage Conditions:
10 mM Tris-HCl
200 mM KCl
1 mM Dithiothreitol
0.1 mM EDTA
200 µg/ml BSA
50% Glycerol
pH 8.0 @ 25°C

Storage Temperature:
-20°C

Diluent Compatibility:
Diluent B


Notes


General notes:
  1. Homing endonucleases do not have stringently-defined recognition sequences in the way that restriction enzymes do. That is, single base changes do not abolish cleavage but reduce its efficiency to variable extents. The precise boundary of required bases is generally not known. The recognition sequence listed is one site that is known to be recognized and cleaved.
  2. Supplied with plasmid DNA. ScaI-linearized pBHS is supplied at 0.5 mg/ml in 10 mM Tris-HCl (pH 8.0), 1 mM EDTA. Cleavage of this 3.5 kb plasmid gives fragments of 2100 and 1400 base pairs.
Usage notes:
  1. Digests should be incubated in 0.5% SDS prior to electrophoresis.

FAQs


  1. Can a double digest be performed with PI-SceI and I-CeuI?

Quality Control for Current Lot


Quality control values for a specific lot can be found on the datacard which accompanies each product.

Ligation and Re-cutting:
After a 20-fold overdigestion with I-CeuI, > 95% of the DNA fragments can be ligated with T4 DNA Ligase (at a 5' termini concentration of 1-2 μM) at 16ºC. Of these ligated fragments, > 95% can be recut with I-CeuI.


16-Hour Incubation:
A 50 μl reaction containing 1 μg of DNA and 50 units of I-CeuI incubated for 16 hours at 37ºC resulted in a DNA pattern free of detectable nuclease degradation as determined by agarose gel electrophoresis.

Exonuclease Activity:
Incubation of a 50 μl reaction containing 50 units of I-CeuI with 1 μg of a mixture of single and double-stranded [3H] E. coli DNA (205 cpm/μg) for 4 hours at 37ºC released < 0.1% of the total radioactivity.

Endonuclease Activity:
Incubation of a 50 μl reaction containing 50 units of I-CeuI with 1 μg of ΦX174 RF I DNA for 4 hours at 37ºC resulted in < 10% conversion to RFII as determined by agarose gel electrophoresis.

Plasmid DNA:
pBHS ScaI-linearized Control Plasmid is supplied at 0.5 mg/ml in 10 mM Tris-HCl (pH 8.0) and 1 mm EDTA. Cleavage of this 3.5 kb plasmid gives fragments of 2,100 and 1,400 base pairs.


Reagents Sold Separately


NEBuffer 4
BSA


Legal


Patents:
New England BioLabs, Inc.: U.S. 5,420,032

New England Biolabs, Inc. is an ISO 9001 and ISO 14001 Certified Company.
NEB certifies that it is a small business in accordance with the US Small Business Administration and 13 CFR 121.201
Privacy, Limitations, Warranty, Disclaimer, Copyright & Trademark