New England Biolabs
To access your account, log in or register.
Products Technical Reference Customer Service My NEB Account
Contact NEB About Us Site Map Request a Catalog OEM at NEB International Orders Freezer Program Quick Order
Related Information
FAQs for PI-SceI
FAQs for Restriction Endonucleases
Technical Reference for Restriction Endonucleases
Favorite Tools
Enzyme Finder
NEBcutter
NEBuffer Chart
Double Digest Finder
Isoschizomers
DNA Sequences
and Maps
REBASE
Related Products
Reagents Sold Separately
NEBuffer PI-SceI
BSA
PI-SceI
Recombinant SourceUnique NEBufferBSA37Heat Inactivated
Catalog # Size Concentration Price Qty  
R0696L 500 units 1,000 units/ml $244.00
R0696S 100 units 1,000 units/ml $61.00
Prices are in US dollars and valid only for US orders.
Download:Technical Bulletin|MSDS PDF


Recognition Site:

ATCTATGTCGGGTGCGGAGAAAGAGGTAAT

isoschizomers | compatible ends | single letter code

Description:
The intein encoding PI-SceI is present in the VMA ATPase gene Saccharomyces cerevisiae (1,5). The gene has been modified for independent expression in E. coli using a T7 RNA polymerase expression system (2).

Source:
A E. coli strain that carries the VMA1 ATPase gene from Saccharomyces cerevisiae (J. Thorner).

Reagents Supplied:
NEBuffer PI-SceI (10X)
BSA
pBSvdeX XmnI-linearized Control Plasmid (5 μg)


Enzyme Properties


Activity in NEBuffers:
NEBuffer 1:0%
NEBuffer 2:0%
NEBuffer 3:0%
NEBuffer 4:0%

When using a buffer other than the optimal (supplied) NEBuffer, it may be necessary to add more enzyme to achieve complete digestion.

Heat Inactivation:
65°C for 20 minutes

Survival in a Reaction:
Minimum units to digest 1 µg of substrate DNA in 16 hours: 0.13 unit(s)


Reaction & Storage Conditions


Reaction Conditions:
1X NEBuffer PI-SceI
Supplemented with 100 μg/ml Bovine Serum Albumin and 5 μg pBSvdeX XmnI-linearized Control Plasmid
Incubate at 37°C.

1X NEBuffer PI-SceI:
10 mM Tris-HCl
100 mM KCl
10 mM MgCl2
1 mM Dithiothreitol
pH 8.6 @ 25°C

Unit Definition:
One unit is defined as the amount of enzyme required to cleave 1 μg of pBSvdeX XmnI-linearized Control Plasmid in 3 hours at 37°C in a total reaction volume of 50 μl.

Concentration:
1,000 units/ml

Unit Assay Substrate:
pBSvdeX XmnI-linearized Control Plasmid

Storage Conditions:
10 mM Tris-HCl
200 mM KCl
1 mM Dithiothreitol
0.1 mM EDTA
200 µg/ml BSA
50% Glycerol
pH 8.0 @ 25°C

Storage Temperature:
-20°C

Diluent Compatibility:
Diluent B


Notes


General notes:
  1. Homing endonucleases do not have stringently-defined recognition sequences in the way that restriction enzymes do. That is, single base changes do not abolish cleavage but reduce its efficiency to variable extents. The precise boundary of required bases is generally not known. The recognition sequence listed is one site that is known to be recognized and cleaved.
  2. Plasmid DNA: XmnI-linearized pBSvdeX is supplied 0.5 mg/ml in 10 mM Tris-HCl (pH 8.0), 1 mM EDTA. Cleavage of this 3.7 kb plasmid with PI-SceI gives fragments of 2550 and 1150 base pairs Enzyme Properties
  3. Supplied with 5 μg of plasmid DNA.
Usage notes:
  1. Digests should be incubated in 0.5% SDS prior to electrophoresis.

FAQs


  1. Can a double digest be performed with PI-SceI and I-CeuI?

Quality Control for Current Lot


Quality control values for a specific lot can be found on the datacard which accompanies each product.

Ligation and Re-cutting:
After a 10-fold overdigestion with PI-SceI, > 95% of the DNA fragments can be ligated with T4 DNA Ligase (at a 5' termini concentration of 1-2 μM) at 16ºC. Of these ligated fragments, > 95% can be recut with PI-SceI.


16-Hour Incubation:
A 50 μl reaction containing 1 μg of DNA and 10 units of PI-SceI incubated for 16 hours at 37ºC resulted in a DNA pattern free of detectable nuclease degradation as determined by agarose gel electrophoresis.

Exonuclease Activity:
Incubation of a 50 μl reaction containing 10 units of PI-SceI with 1 μg of a mixture of single and double-stranded [3H] E. coli DNA (205 cpm/μg) for 4 hours at 37ºC released < 0.1% of the total radioactivity.

Endonuclease Activity:
Incubation of a 50 μl reaction containing 3 units of PI-SceI with 1 μg of ΦX174 RF I DNA for 4 hours at 37ºC resulted in < 20% conversion to RFII as determined by agarose gel electrophoresis.

Plasmid DNA:
pBSvdeX XmnI-linearized Control Plasmid is supplied at 0.5 mg/ml in 10 mM Tris-HCl (pH 8.0) and 1 mM EDTA. Cleavage of this 3.7 kb plasmid with Pl-SceI gives fragments of 2,550 and 1,150 base pairs.


Reagents Sold Separately


NEBuffer PI-SceI
BSA

Privacy, Limitations, Warranty, Disclaimer, Copyright & Trademark