New England Biolabs
To access your account, log in or register.
Products Technical Reference Customer Service My NEB Account
Contact NEB About Us Site Map Request a Catalog OEM at NEB International Orders Freezer Program Quick Order
Related Information
FAQs for PI-PspI
FAQs for Restriction Endonucleases
Technical Reference for Restriction Endonucleases
Favorite Tools
Enzyme Finder
NEBcutter
NEBuffer Chart
Double Digest Finder
PCR Selection Tool
Isoschizomers
DNA Sequences
and Maps
REBASE
Related Products
Reagents Sold Separately
BSA
Discounts, Limited Offers and Value Purchases
PI-PspI
Cloned At NEBRecombinant SourceUnique NEBufferBSA65Not Heat Inactivated
Catalog # Size Concentration Price Qty  
R0695L 2,500 units 5,000 units/ml $252.00
R0695S 500 units 5,000 units/ml $63.00
Prices are in US dollars and valid only for US orders.
Download:MSDS PDF


Recognition Site:

TGGCAAACAGCTATTATGGGTATTATGGGT

isoschizomers | compatible ends | single letter code

Description:
PI-PspI is obtained from a strain of E. coli which expresses the DNA polymerase from the extreme thermophile, Pyrococcus species GB-D (1). The endonuclease is a product of in vivo protein splicing that gives rise to both polymerase and endonuclease from a single polypeptide precursor.

Source:
A E. coli strain that carries the PI-PspI gene from Pyrococcus species (H.W. Jannasch).

Reagents Supplied:
NEBuffer PI-PspI (10X)
BSA (100X)
pAKR7 XmnI-linearized Control Plasmid (5 μg)


Enzyme Properties


Activity in NEBuffers:
NEBuffer 1:0%
NEBuffer 2:10%
NEBuffer 3:10%
NEBuffer 4:10%

When using a buffer other than the optimal (supplied) NEBuffer, it may be necessary to add more enzyme to achieve complete digestion.

Activity at 37°C:
5%

Heat Inactivation:
No

Survival in a Reaction:
(+ + +) Suitable for an extended or overnight digestion. Enzyme is active > 8 hours.
More information about: Extended Digests with Restriction Enzymes


Reaction & Storage Conditions


Reaction Conditions:
1X NEBuffer PI-PspI
Supplemented with 100 μg/ml Bovine Serum Albumin and 5 μg pAKR7 XmnI-linearized Control Plasmid
Incubate at 65°C.

1X NEBuffer PI-PspI:
10 mM Tris-HCl
150 mM KCl
10 mM MgCl2
1 mM Dithiothreitol
pH 9.2 @ 25°C

Unit Definition:
One unit is defined as the amount of enzyme required to cleave 1 µg of pAKR7 XmnI-linearized Control Plasmid in 1 hour at 65°C in a total reaction volume of 50 µl.

Concentration:
5,000 units/ml

Unit Assay Substrate:
pAKR7 XmnI-linearized Control Plasmid

Storage Conditions:
10 mM Tris-HCl
200 mM KCl
1 mM Dithiothreitol
0.1 mM EDTA
200 µg/ml BSA
50% Glycerol
pH 8.0 @ 25°C

Storage Temperature:
-20°C

Diluent Compatibility:
Diluent B


Notes


  • Homing endonucleases do not have stringently-defined recognition sequences in the way that restriction enzymes do. That is, single base changes do not abolish cleavage but reduce its efficiency to variable extents. The precise boundary of required bases is generally not known. The recognition sequence listed is one site that is known to be recognized and cleaved.

    Double-stranded cleavage at the site indicated by arrows yields a four base, 3´ extension. The sequence degeneracy tolerated by this enzyme has not yet been determined. However, digestion patterns from bacterial and yeast chromosomal DNAs indicate that the observed sequence specificity is 8–10 bases under stringently controlled conditions.
  • General notes:
    1. Digests should be incubated in 0.5% SDS prior to electrophoresis. Digests of DNA embedded in agarose should be performed with 1 unit of enzyme per µg of DNA for 3 hours at 50°C.

      Incubation at 37° results in 5% activity.

    FAQs


    1. How can this enzyme be inactivated?

    Quality Control for Current Lot


    Quality control values for a specific lot can be found on the datacard which accompanies each product.

    Ligation and Re-cutting:
    After a 5-fold overdigestion with PI-PspI, > 95% of the DNA fragments can be ligated with T4 DNA Ligase (at a 5' termini concentration of 1-2 μM) at 16ºC. Of these ligated fragments, > 95% can be recut with PI-PspI.

    Cleavage by PI-PspI leaves DNA fragments with four nucleotide 3' extensions. Fragments with complimentary ends can be joined by T4 DNA Ligase.

    16-Hour Incubation:
    A 50 μl reaction containing 1 μg of DNA and 5 units of PI-PspI incubated for 16 hours at 65ºC resulted in a DNA pattern free of detectable nuclease degradation as determined by agarose gel electrophoresis.

    Exonuclease Activity:
    Incubation of a 50 μl reaction containing 50 units of PI-PspI with 1 μg of a mixture of single and double-stranded [3H] E. coli DNA (205 cpm/μg) for 4 hours at 65ºC released < 0.1% of the total radioactivity.

    Endonuclease Activity:
    Incubation of a 50 μl reaction containing 25 units of PI-PspI with 1 μg of ΦX174 RF I DNA for 4 hours at 65ºC resulted in < 10% conversion to RFII as determined by agarose gel electrophoresis.

    Plasmid DNA:
    pAKR7 XmnI-linearized Control Plasmid is supplied at 0.5 mg/ml in 10 mM Tris-HCl (pH 8.0) and 1 mM EDTA. Cleavage of this 3.7 kb plasmid gives fragments of 2,146 and 1,532 base pairs.


    Reagents Sold Separately


    BSA

    New England Biolabs, Inc. is an ISO 9001 and ISO 14001 Certified Company.
    NEB certifies that it is a small business in accordance with the US Small Business Administration and 13 CFR 121.201
    Privacy, Limitations, Warranty, Disclaimer, Copyright & Trademark