 |
|
 |
|
|
| Home >
Products >
Nucleic Acids >
RNA Markers/Ladders >
microRNA Marker |
|
|
 |
|
Prices are in US dollars and valid only for US orders.
|
Description:
This product consists of 6 μg of Marker (12 ng/μl) and 10 μg of Probe (21-mer, 20 ng/μl).
The microRNA Marker is a set of three single-stranded RNA oligonucleotides 17, 21 and 25 residues long that can be used as size markers on denaturing polyacrylamide gels and Northern blots. The single-stranded marker is best visualized by staining with SYBR-Gold instead of ethidium bromide (Figure 1).
The three marker oligos contain the same core sequence so they can be detected by hybridization with the same probe. The sequences of the microRNA marker bands are as follows:
25-mer: 5´AGAGCAGUGGCUGGUUGAGAUUUAA 3´
21-mer: 5´AGCAGUGGCUGGUUGAGAUUU 3´
17-mer: 5´CAGUGGCUGGUUGAGAU 3´
Note: The sequence in bold is common to all three oligos.
A 21-mer DNA oligonucleotide complementary to the marker sequence is included. This oligonucleotide is biotinylated at the 3´ end and has a free 5´ end so it can also be labeled with γ-32P-ATP and T4 Polynucleotide Kinase (NEB# M0201). The sequence of the oligonucleotide probe is as follows:
5´AAATCTCAACCAGCCACTGCT 3´-Biotin
Supplied in: The microRNA Marker is supplied in 4 M urea and 0.04% Orange G loading buffer. The probe is supplied in water.
Figure 1: Lane A: 60 ng of microRNA Marker(5 µl) was loaded on a 12% denaturing polyacrylamide-urea gel which was stained with SYBR Gold (Molecular Probes) for 5 minutes and photographed on a transilluminator. Lane B: 0.2 µg of the Low Range ssRNA Marker (NEB #N0364).
Storage Conditions
Storage Temperature:
-20°C
Notes
Usage notes:- The microRNA Marker is provided in a ready-to-load denaturing solution. Denature by heating for 3-5 minutes at 95°C and place on ice. Load 5-10 µl for staining with SYBR Gold in denaturing gels. In Northern blots, less than 1 µl (12 ng) is sufficient for detection by hybridization.
The Orange G loading buffer migrates faster than the smallest band, and migrates approximately as far as the nucleotides. - Oligonucleotide Probe Usage: The provided biotinylated probe DNA oligonucleotide can be used directly in hybridization and detected with the Phototope Star Detection Kit (NEB #N7020). Use 1 to 10 µl of Probe (20-200 ng) per 10 ml hybridization solution. Hybridize and wash the blot at 35-40°C depending on the hybridization solution used. More details can be found in reference 1 and the Phototope Star Detection Kit manual.
Alternatively, the probe can be labeled with T4 Polynucleotide Kinase (NEB #M0201) and radioactive γ-32P-ATP using the following protocol:
1. Mix the following components in a sterile microfuge tube:
Oligonucleotide Probe 1-5 µl
10X T4 Polynucleotide Kinase 2.0 µl
Reaction Buffer
γ-32P-ATP (5 µCi/µl) 1-2 µl
T4 Polynuclotide Kinase 1 µl
Sterile dH20 X µl
Total volume 20 µl
2. Incubate for 30 minutes at 37°C.
3. Purify labeled probe using a G-25 spin column.
References
- Sambrook, J. and Russel, D.W. (2001) Molecular Cloning: A Laboratory Manual, (3rd ed.), 7.1-7.56. Cold Spring Harbor: Cold Spring Harbor L.
Companion Products
Low Range ssRNA Ladder
Phototope®-Star Detection Kit
siRNA Marker
T4 Polynucleotide Kinase
|
|
|
 |
|
|
