New England Biolabs
To access your account, log in or register.
Products Technical Reference Customer Service My NEB Account
Contact NEB About Us Site Map Request a Catalog OEM at NEB International Orders Freezer Program Quick Order
Related Information
Protocols for Fluorescein-siRNA Transfection Control
FAQs for RNAi and RNA Enzymes
Technical Reference for RNAi and RNA Enzymes
Favorite Tools
Enzyme Finder
NEBcutter
NEBuffer Chart
Double Digest Finder
Isoschizomers
DNA Sequences
and Maps
REBASE
Related Products
Companion Products
Lit28i Polylinker ShortCut® siRNA Mix
TransPass™ HeLa Transfection Reagent
TransPass™ R1 Transfection Reagent
TransPass™ R2 Transfection Reagent
Fluorescein-siRNA Transfection Control
Catalog # Size Concentration Price Qty  
N2100S 1 nmol 10 μM $195.00
Prices are in US dollars and valid only for US orders.
Download:Technical Bulletin|MSDS PDF


Description:
The fluorescein labeled siRNA is used as a control for RNA transfections. The chemically synthesized 21 base RNA has two complementary strands each with a fluorescein linked to the 5´ end base. It has a 19 bp dsRNA region with 2 base 3´ extensions.The sequence of Fluorescein-siRNA Transfection control has no sequence identity to any mammalian sequences in the database.

The sequences of the two complementary strands are given below:

Fluorescein-5´AGGUCGAACUACGGGUCAAUC3´
MW: 7272.6 g/ml

Fluorescein-5´UUGACCCGUAGUUCGACCUAG3´
MW: 7186.5 g/ml

The Fluorescein-siRNA can be used to estimate the transfection efficiency of siRNA with a particular cell line. It facilitates parameter optimization such as cell density, amount of transfection reagent, etc.

Recommended Usage Concentration: 15 nM

Supplied at a concentration of 10 µM in: 20 mM KCl, 10 mM Na-HEPES (pH 7.0) and 0.5 mM EDTA (ready for transfection).

Tested in the following cell lines: HeLa, COS-7, NIH3T3, HCT116.





Figure 1: HCT 116 cells transfected with Fluorescein siRNA Transfection Control using TransPass R1 Transfection Reagent (NEB #M2551).




Reaction & Storage Conditions


Concentration:
10 μM

Storage Temperature:
-20°C
Protect from light.


Notes


General notes:
  1. It is important to maintain healthy cells. Some cell lines become more sensitive to transfection agents after a large number of passages. It is advisable to use cells subjected to a similar number of passages to ensure reproducible transfection results in different experiments.
  2. It is recommended that control transfections be performed by varying cell confluence and using different amounts of TransPass Transfection Reagent. In general, low cell density or too much transfection reagent increase the risk of cell toxicity. The medium may be replaced 24 hours after transfection with fresh complete medium to increase cell viability.
    In order to easily estimate the efficiency of transfection of particular cell lines use the Fluorescein-siRNA Transfection Control (NEB #N2100S).
  3. TransPass R1 Transfection Reagent has been used to successfully transfect siRNAs in many cell lines including: A549, C6, CHO, COS-7, HEK293, NIH 3T3, HepG2, HCT116, HeLa, Jurkat, MCF-7, U2OS, 3T3-L1 preadipocytes.
  4. Transfection of siRNA Mixtures: The transfection of siRNA must be optimal in order to obtain maximum silencing of a target gene. Optimizing the following parameters may be necessary in order to maximize the transfection efficiency for a particular cell line: the cell density at the time of transfection, the amount of transfection reagent, the amount of siRNA and the culture incubation time before analysis.

Quality Control for Current Lot


Quality control values for a specific lot can be found on the datacard which accompanies each product.

Quality Assurance Statement:
Purified by gel electrophoresis.


Companion Products


Lit28i Polylinker ShortCut® siRNA Mix
TransPass™ HeLa Transfection Reagent
TransPass™ R1 Transfection Reagent
TransPass™ R2 Transfection Reagent

Privacy, Limitations, Warranty, Disclaimer, Copyright & Trademark