 |
|
 |
|
|
| Home >
Products >
Protein Expression and Purification >
Yeast >
K. lactis YCT284 Competent Cells |
 | | | | K. lactis YCT284 Competent Cells | | | |
|
|
 |
|
Prices are in US dollars and valid only for US orders.
|
Description:
Chemically competent Kluyveromyces lactis YCT284 (∆cts1) cells are a preferred host for secreting heterologous proteins carrying a chitin binding domain tag. YCT284 cells can be transformed with any linearized pKLAC-series expression vector. K. lactis strain YCT284 carries a selectable marker-free deletion of the KLLA0C04730g locus encoding an extracellular chitinase (KlCts1p) which can degrade chitin chromatography resin and compete for resin binding sites (1).
Strain: K. lactis strain YCT284 (∆cts1). No auxotrophies or genetic markers.
Reagents Supplied with Cells: NEB Yeast Transformation Reagent (NEB #M2570). Store at 4°C.
Storage Conditions
Storage Temperature:
-80°C
Notes
General notes:- Store Competent Cells at -80°C. Once Thawed, Do Not Re-freeze.
Usage notes:- Due to the high transformation efficiency of K. lactis YCT284 (∆cts1) Competent Cells, plating multiple dilutions of the cell mixture is necessary to ensure formation of plates with distinct single colonies. Growth time should not exceed 5 days as small colonies that lack an integrated expression fragment may form.
Plates containing colonies can be stored at 4°C for up to two weeks.
K. lactis YCT284 (∆cts1) Competent Cells may form small clumps when grown in liquid culture (1). This can obscure cell density measurements using light scattering techniques.
The deletion of locus KLLA0C04730g in YCT284 can be confirmed by PCR using the primers GGTCACCAGAAATACAAG and ATAAAAATATGATAAGGCTACACG to amplify a 2.0 kb diagnostic fragment.
The chitin binding domain (KlChBD) derived from the K. lactis secreted Cts1p chitinase (1) is not suitable for cytoplasmic expression and purification of KIChBD-tagged proteins.
FAQs
- Why does NEB offer K. lactis protease deletion strains?
- What K. lactis protease deletion strains does NEB sell?
- Which protease deletion strain should i use?
- What vectors may be used with protease deletion strains?
- What is the parent background for the protease deletion strains?
Protocols
Protocols for K. lactis YCT284 Competent Cells
Quality Control for Current Lot
Quality control values for a specific lot can be found on the datacard which accompanies each product.
Competency:
One microgram of linearized pKLAC1-malE was used to transform one tube of K. lactis ∆yps1 (YCT389) Competent Cells following the protocol provided. Greater than 1 x 104 colonies formed after a 3 day incubation at 30°C. Use of cells beyond the expiration date may result in lower transformation efficiency.
Sterility:
One tube of competent cells and 100 μl NEB Yeast Transformation Reagent were spread onto individual YCB Agar Medium plates containing 5 mM acetamide and incubated at 30°C for 3 days. No bacterial or fungal growth was detected.
References
- Colussi, P.A. et al. (2005) Appl. Environ. Microbiol, 71, 2862-2869.
Legal
Patents:
New England Biolabs, Inc.: U.S. Patent No. 7,517,671
Licenses/Patents/Disclaimers:
Notice to Buyer/User: K. lactis Competent Cells are a component of an expression system that was developed from basic research at New England Biolabs and DSM Biologics Company B.V. The buyer and user has a non-exclusive sublicense to use this system or any component thereof, including the K. lactis GG799, YCT284, YCT569, YCT389, YCT390 and YCT598 Competent Cells, for RESEARCH PURPOSES ONLY. A license to use this system for manufacture of clinical grade material or commercial purposes is available from New England Biolabs, Inc., or DSM Biologics Company B.V.
|
|
|
 |
|
 |
|
|
